[Histonet] CISH advice for zoox in FFPE Exaiptasia

Gudrun Lang gu.lang at gmx.at
Fri May 29 01:53:16 CDT 2026


Hi Julie,
in-situ-hybridization usually works with cocktails of probes. One probe
about 50 nt. It needs about 20-30 of these to get a detectable signal - at
least with FISH. For CISH it may be less.
The target sequence often spans several hundreds bp.
Have you taken this into account? There may be just too few for a signal.

that's what came into my mind.
regards
Gudrun

-----Ursprüngliche Nachricht-----
Von: Tilley, Julie via Histonet [mailto:histonet at lists.utsouthwestern.edu] 
Gesendet: Donnerstag, 28. Mai 2026 21:50
An: histonet at lists.utsouthwestern.edu
Betreff: [Histonet] CISH advice for zoox in FFPE Exaiptasia

Hello everyone, we are looking for some advice.
We're trying to localize zooxanthellae in Formalin-fixed paraffin-embedded
Exaiptasia tissues using chromogenic in situ hybridization, but so far we
haven't had any success. We've tested multiple retrieval conditions - heat
retrieval at pH 6 and pH 8, proteinase K (25, 50, and 100 µg/mL), cellulase
(1 mg/mL), and HCl (0.2N) - along with several DIG labeled probes targeting
Symbiodinium clade B genes (published 18S "SymB_DIG" by Yokouchi et al.
2003, and designed in house 28S "B1-rev_DIG", ITS2, cytochrome b
"cob-rev_DIG", and chloroplast "cp23S-rev_DIG").
qPCR shows strong amplification (Cq < 25) for all these targets, so we're
confident the sequences are present in the tissues. We also included
positive controls in every experiment, and those consistently worked as
expected.
If anyone has suggestions on what we should try next, we'd really appreciate
your insight.
Thanks so much for any guidance you can share!

Probe sequences:
ITS2-rev_DIG: 5'-/5DigN/GCAAACAAGCCATTTACGAAC -3'
cob-rev_DIG: 5'-/5DigN/ATCTAGAGCTTACCCACACG -3'
cp23S-rev_DIG: 5'-/5DigN/CCTTTAGTGTCAGCAGCATA -3'
SymB_DIG: 5'-/5DigN/GGGCAAGATCGAAAACTTG-3'
B1-rev_DIG: 5'-/5DigN/CTTGTTTGCTATTGGTCTCG-3'

References:
Yokouchi, H., Takeyama, H., Miyashita, H., Maruyama, T., & Matsunaga, T.
(2003). In situ identification of symbiotic dinoflagellates, the genus
Symbiodinium with fluorescence-labeled rRNA-targeted oligonucleotide probes.
Journal of Microbiological Methods, 53(3), 327-334.
https://doi.org/10.1016/s0167-7012(02)00250-6.

Protocol from: Conway, C. M., Purcell, M. K., Elliott, D. G., & Hershberger,
P. K. (2014). Detection of Ichthyophonus by chromogenic in situ
hybridization. Journal of Fish Diseases, 38(9), 853-857.
https://doi.org/10.1111/jfd.12300




Julie Tilley
Biological Science Lab Tech
USGS-National Wildlife Health Center
820 Mililani Street, Suite 300
Honolulu, HI 96813
(O): 808-535-9112
(C): 808-970-0355


_______________________________________________
Histonet mailing list
Histonet at lists.utsouthwestern.edu
http://lists.utsouthwestern.edu/mailman/listinfo/histonet




More information about the Histonet mailing list